Sentence examples for application of significance from inspiring English sources

Exact(1)

It can be contrasted with the more traditional application of significance testing approaches (such as PCIT) to expression profiles, which produce co-expression networks.

Similar(59)

In order to determine the magnitude of loss of methylation at significant sites/regions for single sample case-control analysis, application of a significance test alone is not ideal [ 37].

(A ): Heat map showing alternative conclusions reached for different choices of T, the number of mixture pairs per class to test, and application of alternative significance threshold α for discriminability, with the data from (Bushdid et al., 2014 ).

The sequences used for illustration in Figures 1, 2, 3, 4, 5, 6 are: Example 1: SSA version I, R = ' GAGCAUCCGUGUAACCAUUCACACUGCUC ' Example 2: SSA version I, R = ' GGGGGGGGGGGGAAAUCCCCCCCCCCCC ' As a possible application of biological significance, the time-dependent approach discussed above is suggested for beneficial use in the problem of deleterious mutation prediction.

Following a broader discussion of issues surrounding the formulation, application and interpretation of significance criteria, conclusions and recommendations relevant to wider EIA practice are suggested.

Insecurity related to the specific design and functioning of the application might be of significance, but at the time of this study it was not possible to provide respondents with additional information about the user interface of the application and to what degree it would require active involvement on their part.

Because of the confirmative nature of the test on this application, the level of significance is set at p = 0.1.

The boundary effect in electrophoresis can play an important role in applications of practical significance; typical example includes the electrophoresis in a narrow space and that of a concentrated dispersion.

Impacts include discovery and applications of global significance, such as the use of nevirapine to prevent HIV transmission in childbirth and male circumcision for HIV prevention.

This article analyzes the present platform application and significance of sport network teaching in college and universities.

A parametric study of some 192 sample cases of two different composite systems (i.e., glass fiber/epoxy and ceramic fiber/ceramic) is conducted to illustrate the application and significance of the newly derived analytical model.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: