Pairwise interaction data were represented as binary presence/absence values; where applicable, interaction profile similarities were calculated between genes from binary data using an inner product.
The general GenoMesh algorithm is applicable not only to study of other microbial organisms but to study eukaryotic systems (e.g., human and mouse) and is also applicable to study the interactions between host and pathogens.
To elucidate the mechanism of multimeric assembly, we have devised two rapid and broadly applicable strategies for examining cooperative interactions between proteins bound to RNA, one based on cooperative translational repression of a two-site reporter and the other on gel shift analysis with crude E. coli extracts.
Moreover, the BLI binding assay we used should be applicable to the study of interactions between Ess1 and longer peptides or intact protein substrates that contain multiple Ser-Pro sites.
The sequence of β-tubulin (TUB2; GenBank # EU402967) was obtained by amplifying genomic DNA from strain SCOH1-5 with primers TubF (AACAACTGGCCAAGGGTCACTA) and TubR (GTCGAAGATTTGCTGGGTGAGCTC). 1 n/a = not applicable During the interaction between C. zeae-maydis and maize, two key aspects of the disease cycle are colonization of host tissue and the production of conidia for secondary inocula.
First, it is most applicable for the investigation of early paracrine interactions between tumor and bone which are not mediated by cell-cell or cell-matrix interactions.
Our modelling approach is applicable to forest management, providing an overview of interactions between browsing by cervids and young tree regeneration processes.
These findings, if applicable to the wider population, may have application in a range of psychiatric disorders where interactions between emotion and cognition are relevant.
Note that the previously discussed cases, which neglect interactions between populations or within populations, are applicable to particular social systems only.
Our data about putative interactions between EBV and KSHV would be applicable to the majority of AIDS-associated PELs and may be relevant to the pathogenesis of PELs.
