Sentence examples for antisense oligodeoxynucleotide from inspiring English sources

Exact(41)

This antisense oligodeoxynucleotide did not interfere with S-PhGPx.

We found that the antisense oligodeoxynucleotide (5′ GCCGAGGCTCATCGCGGCGG 3′) was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity.

We designed an antisense oligodeoxynucleotide (AS-1/TF) for rat TF and studied its effect on hepatic ischemic reperfusion injury.

To evaluate the inhibitory effect of heparanase antisense oligodeoxynucleotide (AS-ODN) on the angiogenesis and metastasis of human mammary carcinoma cell xenografts in nude mice.

For example, intracerebroventricular administration of insulin decreases food intake and body weight, whereas antisense oligodeoxynucleotide downregulation of insulin receptors (IRs) produces hyperphagia.

Due to their high cationic charge density at physiological pH, PEIs are able to form non-covalent complexes with DNA, siRNA, and antisense oligodeoxynucleotide. Therefore, PEIs hold a prominent position among the polycationic polymers used for gene delivery [16 18].

Show more...

Similar(19)

Antisense oligodeoxynucleotides can inhibit specific protein expression.

Based on confocal and flow-cytometric studies, efficient intracellular transporting, strong cell nucleus localization, and high delivery efficiency of antisense oligodeoxynucleotides were exhibited by this system in comparison with free antisense oligodeoxynucleotides in HeLa cells.

Mercaptoacetic acid-capped CdTe quantum dots, as fluorescent probes, were linked to antisense oligodeoxynucleotides to suppress telomerase expression.

Antisense oligodeoxynucleotides (ODNs) have been used extensively to decrease or prevent the synthesis of target proteins.

Antisense oligodeoxynucleotides have proved useful in correlating opioid receptor clones with those defined pharmacologically.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: