Your English writing platform
Discover LudwigSuggestions(1)
Exact(1)
The upstream primer (5' TGCTGAAAGAAAATACCAGA 3') spanned an endogenous XbaI site, while the downstream primer (5' GC TCTAGAGAAAAAGCAGTTTGGGTACT 3') introduced another (underlined sequence).
Similar(59)
Means with different format (normal, bold, italics, or underlined) are statistically different one from another (at the level α=0.05).
(They're called 'non-extensional contexts' because 'extension' is another term for 'reference.') Because both of the underlined sentences are true, (9) and (10) are a pair of sentences which differ only with respect to substitution of expressions (namely, the underlined sentences) with the same reference.
You spot an underlined "link," click on it and go down one step, then another, then another then realize you're in the wrong place.
Your attendance essential" - underlined three times.
Cut underlined means I really want you to cut it.
Leon Osman underlined his enduring importance to the club on the day he signed a one-year contract extension with the game's opening goal, the defender Jagielka scored his fourth goal in 10 games and Steven Naismith completed the victory after another incisive Everton move.
The title is underlined and divided across three lines.
Both elements are interesting; both are underlined way too heavily.
The presidential election has merely underlined that reality.
Underlined, gRNA target regions.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com