Sentence examples for another fragment of from inspiring English sources

He muses about the constant, senseless striving that was his life, and fall asleep He stirs from sleep to tell Nona another fragment of his past.

The next morning, I drove to the nearby Le Domaine de l'Etoile, again another fragment of natural forest with trees rare enough to stop a motorway construction.

The publication of this information by Guardian Australia is another fragment of detail about the plight of the people we are so miserably failing in our duty to protect.

In front of G 2381 A, in rock, another sloping passage, G 2381 C. North of it, a pit G 2382 A. In debris on rock another fragment of face [12-12-175, attributed to Khafre] found yesterday.

In a news release, Michael Brand, the director of the Getty, said that the museum decided to return the fragment, which dates to the first century B.C. and depicts a landscape, after seeing a published image of another fragment of the fresco being returned to Italy by a private collector.

Another fragment of evidence is that the average illiteracy rate of men in the seven countries the State Department designated as sponsors of terrorism (Cuba, Iran, Iraq, Libya, North Korea, Sudan and Syria) is 17percentt -- about the same as the worldwide illiteracy rate.

As Brook wrote in an introduction to a printed edition of "Marat/Sade," "A play in performance is a series of impressions; little dabs, one after another, fragments of information or feeling in a sequence which stir the audience's perceptions".

Today, the building is a small museum, preserving another small fragment of Germany's anguished 20th-century history.

One class encodes a full- length 243 aa protein, and another a fragment of the C-terminal end which consists of 94 aa.

Another 327bp fragment of CYP81A6 cDNA was obtained by PCR from the same rice genomic DNA using the primer 450F, and the primer 450R2 (5' AGA TCTCGGTGAAGCACTCCCTGGCGCAC, a BglII site was attached and underlined).

Another DNA fragment, of 587 bp, was excised from pUC19 by digestion with HaeIII.