Sentence examples for and was present in a from inspiring English sources

One is the performance-enhancing substance commonly known as speed whereas the other - which Baxter claimed was in his sample - is a decongestant and was present in a Vicks inhaler he used.

In these particles, DNA showed laddering by gel electrophoresis and was present in a form that allowed direct binding by a monoclonal anti-DNA antibody, suggesting antigen accessibility even without fixation.

The limiting primer (5' - GCCCGGAGCGAGGAGAGTAGCACTCTTG - 3' target 16340 16458) had a concentration adjusted Tm of 68°C and was present in a concentration of 0.05 µM.

In unwounded mice, CTGF expression was absent in epidermis and was present in a few cells in the dermis.

Staining intensity increased with increasing pathology grade and was present in a nuclear, perinuclear or plasma membrane pattern.

The sequence is related to that of type B and type D retroviruses and was present in a sucrose density gradient fraction corresponding to that of an enveloped retrovirus particle.

Uber serves close to 30 cities in Brazil, and is present in a total of 12 countries across Central and South America.

Uber serves close to 30 cities in Brazil, and is present in a total of 12 countries across Central and South America.

Ferulic acid is ubiquitous in plant cell wall components and is present in a wide range of natural sources.

The latter has a complex quaternary structure and is present in a crystalline form within the secretory granule.

NIS is also known to play a role in the breast and is present in a functional capacity in lactating breast tissue [2].