Sentence examples for and this sequence was from inspiring English sources

But the show was too long, and this sequence was deemed superfluous, so was never performed again.

Only one peptide (ITDQNIWENNTYPK) was identical to CPE1281, and this sequence was also shared by the NE homolog (Figure S2).

GRD2 is represented by only a single sequence within N. tomentosa and this sequence was therefore not included in any further analyses.

A siRNA sequence specific for human Dsg3 mRNA, corresponding to nucleotides 620 to 640 of the respective coding region (Accession: NM_001944.1) (AAATGCCACAGATGCAGATGA) was designed and this sequence was subjected to a BLAST database search prior to being synthesised by Dharmacon Research USAA).

The blocks were randomized to determine the measurement sequence and this sequence was reversed for the second session.

In each species, only one type I ST was found, and this sequence was designated ST1 in each species.

Given its presence in Ciona and basal vertebrates, this sequence was most likely lost in mammals.

The 5′UTR sequence was revealed by sequencing and then verified by showing that this sequence was spliced out.

And this sequence isn't a happy-ever-after resolution.

And this sequence is something very special because, well, it creates a feeling of identity".

However, when the light glows, the night is suddenly no longer dark, so the electric eye, mindless servant that it is, switches the fixture off, and this sequence is repeated ad infinitunum.