Sentence examples for and template in the from inspiring English sources

Zn II) coordination polymer has been demonstrated as both precursor and template in the preparation and surface modifications of nanomaterials.

Secondary structure score : we evaluate the secondary structure similarity between the target and template in terms of both the 3-class and 8-class types.

For a given set of primers and template, differences in the C t) correlate with the amount of starting template.

The ionic liquid [Bmim]BF4is used as the reactant and the template in the synthesis.

Controls with no enzyme and no template in the reaction were prepared in parallel.

The primers were designed to amplify both methylated and unmethylated template in the same reaction.

3. Management of school surveys process and development of BoQs  Prepare tools and templates, in collaboration with the Department of Basic Education, for creating BoQs for schools to be prepared.

A different impedance behavior was observed at different ratio of polymerized monomer and template molecule in the polymerization media.

The newly proposed methods, such as template pruning and filtering [19], template-like dimension reduction of speech observations [20], and template matching in the second-pass decoding search [21], are beginning to address this problem.

Both PCR products were gel purified and used as template in the final PCR reaction using primers ATTCCAGATATGCGTTATAACCT and GGAATTCCCAACCATGTGGTCTGACACCAAACATAATGG.

The template deformation is a model fitting procedure driven by the difference between the input skull and the template, in which the model parameters are adjusted by optimization method.