Your English writing platform
Discover LudwigSuggestions(1)
Exact(20)
Genomic DNA was isolated and restricted with the respective restriction enzymes indicated in each panel.
The PCRed plasmid (5.914 kb) was gel purified using NucleoSpin® Gel and PCR Clean-up kit and restricted with NdeI and SacI restriction enzymes.
The 3′pac-2A-GT-ECFP pofthen of the insert was then removed by BglII restriction, blunt-ended (Klenow fill-in) and restricted with SacII.
The PCR product (714 bp amplicon) was purified using NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL GmbH & Co #740609) and restricted with NdeI (NEB # R0111L) and SacI (NEB #R0156L) restriction enzymes following manufacturer's supplied protocol.
Imprisoned by the government without charge for years and restricted with a gag order thereafter.
It is also revealed that the radial and axial clearances are interrelated and restricted with each other.
Similar(40)
A ccpA fragment truncated at the 3' end was amplified from plasmid pWH1533 [ 56] using primers ccpAmut1 and Accout, restricted with BsrGI and KpnI and cloned into vector pWH618 [ 56].
To construct the pET21b-mEos2 plasmid, mEos2 was amplified from pRSET-mEos2 plasmid (gift from McKinney [26]) using primers GATCGCTAGCATGAGTGCGATTAAG and GATCCTCGAGTTATCGTCTGGCATTGTC, restricted with NheI and XhoI (underlined), and ligated into a similarly digested pET21b plasmid (Novagen).
ProJcSDP1 was amplified with two primers, JcSDP1-PF1 andI and JcSDP1-PR1 XhoI, and then restricted with ApaI/ XhoI.
The pros: No food groups are down and out restricted with this diet, and there is that one day where you get to "healthily binge".
Hence, movements were purely reactive, and thus restricted with regard to both time point and movement lateralization.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com