Sentence examples for and relative expression changes were calculated from inspiring English sources

Relative expression levels were calculated as ΔΔCT=ΔCTDex ΔCTcontrol and relative expression changes were calculated as 2−ΔΔCT.

The average threshold cycle (Ct) was normalized and the relative expression changes were calculated using the 2−△△Ct method.

Relative Expression changes are calculated relative to B2M (B2Ms: TGCTGTCTCCATGTTTGATGT ATCT and B2Mas: TCTCTGCTCCCCACCTCTAAGT).

Relative gene expression change was calculated according to ΔΔCt method.

Relative expression levels (fold changes) were calculated according to the formula 2−[(Te-Tn -(Ce-Cn)].

Relative gene fold changes were calculated by the comparative Ct method (2−ΔΔCt) and expression of the target genes was normalized to the β-actin.

Fold changes were calculated relative to controls.

Fold changes were calculated by relative quantification.

The fold changes were calculated in relation to samples treated with vehicle (DMSO) using relative expression software tool REST.

Relative gene expression (fold changes) was calculated based on N with the lowest value as 1.

Relative expression (fold change) was calculated using the 2-ΔΔCT method [ 62].