Your English writing platform
Discover LudwigExact(1)
Eject or remove the medium where the contacts are copied and insert the same in your MacBook.
Similar(58)
F old-and-dock assumes that secondary structural elements of a homomer are symmetric and inserts the same fragments into every subunit.
Yarn over at the front again (loop 6) and insert the hook into the same stitch another time.
Yarn over (loop 4) and insert the hook into the same stitch.
To generate Cdc24-GFP-CAAX and Cdc24-CAAX (as well as nonphosphorylatable derivatives (Kuo et al., 2014)), we constructed new vectors for PCR-based C-terminal tagging of genomic loci (Longtine et al., 1998): pFA6a-GFP S65T -CAAX and pFA6a-GFP S65T -CAAXe sand polybasic-prenyl motinsert
If you do not have a Print Screen button on your keyboard, try pressing "Function (FN)" and "Insert" at the same time.
AtHMA4-trunc was amplified with primers 5'CTCGGATCCGAAAATGGCGTTACAAAACAAAG and 5'GCGGTACCTCACTTTTTGTTCCCAATCTTTTTCTTCTCTC, digested with BamHI and KpnI and inserted into the same sites of pBECKS400.6.
EGFP was amplified from pKT127 (Euroscarf) [ 41] using primer set EGFP-F and EGFP-R, digested with NotI and SphI and inserted into the same restriction sites of pYES2ABC2-1 to create pYES2ABC2-EGFP.
We observed three distinct patterns of duplication events for B3 genes according to their duplication origin: genes that were duplicated and inserted in different chromosomes, genes that were duplicated and inserted in the same chromosome and genes that were duplicated in tandem.
There are several fascinating examples on the way – and all, in some ways, insert the same sorts of questions between player and character.
The product was digested with NheI and XhoI and inserted into the same sites in pET28a.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com