Your English writing platform
Discover LudwigSuggestions(1)
The phrase "and complemented using the" is correct and usable in written English.
It can be used when discussing how something is enhanced or completed by means of a specific method or tool.
Example: "The design was innovative and complemented using the latest technology to improve functionality."
Alternatives: "and enhanced with the" or "and supplemented by the".
Exact(1)
Then the BNA results have been calibrated against and complemented using the residual stress values measured using X-ray diffraction.
Similar(59)
These newly engineered mutant strains, PAO1-fadD1::FRT, PAO1-fadD2::FRT, and PAO1-ΔfadD2D1::FRT, were complemented using the relevant gene(s) on the miniCTX2 single copy integration vector as described previously [56].
Leaching data were verified and complemented using chemical equilibrium calculations.
The data are complemented using institution-level information on financial and logistical support for entrepreneurial activities.
The methods described earlier can be complemented using gene expression data.
This can be complemented using information obtained by much more accurate sensors such as kinect.d.
5448ΔdltA was complemented using plasmid pdltA, as described [13], creating 5448ΔdltA pdltA).
We assessed each CNV-mediating HERV element for matches to the motif's position weight matrix and its reverse complement using the Biostrings package.
Plasmid pCMV/myc/mito- hOGG1 (MTS- hOGG1) was then used to generate a mutant at amino acid position 229, by changing CGA (Arginine) to CAA (Glutamine) using primers 5' CTGGCTGCAGCAGCTACAAGAGTCCTCATATGAG 3' and its reverse complement, using the site directed mutagenesis kit (Stratagene, La Jolla, CA).
We started with the chromosomal evolution hypothesis of strawberry and peach elaborated by Vilanova et al. [ 28], modified it with the new data provided by this research, and then constructed the apple chromosome complement using the more complete Prunus- Malus comparison mainly.
A single mutant was selected and its pyrE allele was repaired, complemented and overexpressed using the ACE vectors pMTL-ME6, pMTL-ME6C:: amyP and pMTL-ME6X:: amyP, respectively, as described for the spo0A mutant.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com