Sentence examples for analysis expression for from inspiring English sources

Exact(2)

In concordance with the SAGE data and TPE analysis, expression for SPRR2A was only observed in PBEC.

The 15 genes used for the cluster analysis, expression for four of which was increased in the infected animals, included some genes with functions that are not well described in any species.

Similar(58)

Prior to genetic analysis, expression levels for each gene were normalized using a van der Waerden normal score.

For NetLIFT analysis, expression data were corrected for GC content and batch and were normalized as described previously.

For analysis, expression levels of the housekeeping gene rp49 were used as an RNA loading control.

Shiraki, T. et al. Cap analysis gene expression for high-throughput analysis of transcriptional starting point and identification of promoter usage.

Based on dimensional analysis, an expression for the fundamental frequency is derived in terms of the stagnation sound speed, cavity length, and stand-off distance.

Microarrays allow high-throughput analysis of expression for thousands of genes and provide valuable information for tumor studies.

For PCR, mouse-specific primers were used for the analysis of expression for the following molecules: MyoD F 5′- AGTGAATGA GGCCTTCGAG A -3′, R 5′- GCATCTGAGTCGCCACTGTA -3′.

Based on the PCR verification, seven transformants were selected for further analysis for expression of the inserted genes.

In Section "Asymptotic analysis", the approximate expression for ergodic capacity is given firstly, and then the asymptotic expressions for OP and SER in the high SNR regime are presented.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: