Sentence examples for an universal polymerase from inspiring English sources
An universal polymerase chain reaction using primers amplifying ribosomal RNA did not reveal a product [ 15].
Both probes consist of a short target sequence and a universal polymerase chain reaction (PCR) primer-binding site.
A large variety of genes produce a few universal polymerase modules the 'knot' of the bowtie and a large variety of proteins result [ 26].
Universal polymerase chain reaction (PCR) is subsequently applied to amplify cDNAs for sequencing.
Using universal polymerase chain reaction HIV-1, HIV-2, and SIV primers, we detected 1 (1.4%) HIV-1 sequence.
For complete mtDNA resequencing we used the mitoSEQr™ kit (Applied Biosystems) designed to amplify human mitochondrial DNA in 46 fragments using universal polymerase chain reaction (PCR) conditions.
Other new approaches such as universal polymerase chain reaction (PCR) make it possible to identify bacteria quickly and reliably, but these are not routinely available in most centers [ 9].
For each 20 μl TaqMan reaction, 9 μl cDNA was mixed with 1 μl 20× TaqMan Gene Expression Assays and 10 μl of 2× TaqMan Universal polymerase chain reaction (PCR) Master Mix Applied Biosystemss, US).
Among strategies without decolonisation, universal polymerase chain reaction screening was unlikely to be cost effective within the usual NHS range of £20 000 to £30 000 per QALY gained, with chromogenic agar based screening and strategies targeting high risk patients being favoured.
This was realized by the design of (i) a "universal" oligonucleotide "tagged" polymerase chain reaction (PCR) forward primer, (ii) a sensor sequence complementary to the universal sequence on the forward PCR primer modified with a fluorescent dye, and (iii) a universal oligonucleotide coupled to Luminex microspheres.
The template DNA was amplified in a second round of PCR with a universal primer bearing the T7 RNA polymerase promoter sequence followed by the anchor sequence (TAATACGACTCACTATAGGGAGACCACGGGCGGGT).
