Sentence examples similar to an internal control report from inspiring English sources

Similar(60)

It requires an annual "internal control report", which must be certified by auditors and personally signed off by two executives.

During this same period, the US Securities and Exchange Commission SECC) vacillated between actively advocating mandatory internal control reporting and passively acquiescing to industry and White House demands for voluntary internal control reporting.

This change is designed to ensure that internal control reporting requirements, and associated costs, are appropriately scaled to the size of the company.

We first examined WT1 expression in infant ALL cell samples obtained from bone marrow of the patients using quantitative real-time polymerase chain reaction of WT1 mRNA and glyceraldehyde-3-phosphate dehydrogenase mRNA as an internal control, as reported previously.

Levels of 18S rRNA designed from the genome of C6/36 or BHK-21 cells were also amplified as an internal control as our previous report [ 25].

The pullulanase gene (CAC2679) was used as an internal control according to the previous report [ 110], and the microarray result here also indicated that CAC2679 had a constant expression profile in both the 824WT and 824ccpA strains (Additional file 2).

The JOBS Act passed by Congress last week and being signed by the president on Thursday helps smaller public companies avoid for a few years the internal controls reporting and audit requirements put in place in 2002 in the wake of prominent accounting scandals.

Two election variables – election of the Finance official and use of term limits for City Council and the mayor – are evaluated to determine if a relationship with the prevalence of internal control weaknesses reported exists.

Specific primers were designed against coat protein gene of ApMV while for ACLSV & internal control previously reported primer sets were used.

RT-PCR was performed with two sets of primers (IGFBP-2a: 5'- CGATGTTGTCCTATGTGAGT -3' and 5'- GATCACCTCTTATCAGTGGA-3' IGFBP-2b: 5'- GCATGTCTCTTGCATTGCTC -3' and 5'- CGGACGAGGGTATCTGGACA-3') using Taq-DNA polymerase with ornithine decarboxylase (odc) mRNA as internal control as reported previously (21).

For example, for our smaller public companies, we will be taking a fresh look at the "accelerated filer" definition and the thresholds that trigger Section 404(b) of the Sarbanes-Oxley Act of 2002, which requires certain registrants to provide an auditor attestation report on internal control over financial reporting.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: