Sentence examples for an incorrect start from inspiring English sources

Exact(4)

He told investigators he put an incorrect start date on it to make himself appear more involved with Gotham than he was.

If the 5′ end of the transcript is incomplete then the predicted gene will have an incorrect start codon, or be completely missed.

For 72 genes, 66 CDS and 6 RNAs, TSS mapping predicted the primary TSS internal and downstream of the annotated gene start, suggesting that an incorrect start codon might have been predicted and the gene is shorter than annotated.

Site directed mutagenesis was used to remove an ATG from the parental cloning vector (CATTATACGAAGTTA GGGATCAGGCCAAATCGGCCG where the underlined G marks the nucleotide that was changed from a T) so that a NotI/KpnI double digest would excise the Vg cDNA from the vector and not contain an incorrect start codon.

Similar(52)

The Flyers had seven power plays during the game, including one on a bench minor at 18 seconds when the Islanders were penalized for an incorrect starting lineup.

A map on Monday with the continuation of an article about the complex logistics Israel would face if it decided to strike Iran showed an incorrect starting point in some copies for one of three flight paths Israeli jets might use.

The Public Goods hypothesis does not view any tree as being of particular significance as the process of evolution does not follow any particular tree and indeed tree-thinking is an incorrect starting point, likely to conflate explanandum and explanans.

A significant problem in single-particle analysis is that an incorrect starting model can bias the result or even completely invalidate it, and there are examples in the literature of dissimilar or completely different EM structures for the same biological complex.

First, we looked for alignment of the initial Methionine (Met) amino acid to a downstream Met in multiple proteins, which may point to the less common initial Met being an incorrect translation start position.

The differences between GLEAN_20241 and NP_788839.1 were caused by an incorrect translation start and several sequencing errors that included 3 amino acid substitutions in exon three, one amino acid substitution in exon five, a sequencing error of 18 amino acids in exon ten, and a sequencing error of 13 amino acids in exon thirteen.

Aggregating data and displaying discrepancies between annotations would present reviewers with an extensive number of possible errors including false positives, uncalled genes, genes without a predicted function, incorrectly predicted functions, and incorrect start sties.

Show more...

Your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: