Sentence examples for an housekeeping from inspiring English sources

Amplification of Arginin Rich Protein (ARP), used as an housekeeping gene, was performed using the following primers forward 5'-GAACGTCGTCTTCGTGTTCA-3', reverse 5'- AAAACCTGGACGAAGGAGGT -3'.

To determine the quantity of PCMT transcript present in the antisense-PCMT-infected HUVEC, relative to uninfected ones, their respective Ct values were first normalized by subtracting the Ct value obtained from the evaluation of the GAPDH transcript, chosen as an housekeeping gene (ΔCt = CtPCMT−CtGAPDH).

H3B2 was used as an housekeeping gene (F: 5′-GCTAGCTGGATGTCTTTTGG-3′ and R: 5′-GTGGTAAAGCACCCAGGAA-3′) as previously described [ 20].

To assess the siRNA specificity for HIF-1α, we checked the expression of PCNA, a product of an housekeeping gene in both transfected and untransfected cells (data not shown).

This is made possible by the integration of different attributes operated by the Naive Bayes engine, since the attributes already discovered in literature (like the association between exon length and being an housekeeping gene) were not powerful enough, taken alone, for deciding if a gene was housekeeping or not.

Phosphofructokinase A (pfkA), a housekeeping gene, was used as positive control.

In most cases, this phenotype was associated with a mutation in a housekeeping gene.

The real-time RT-PCR assay included a housekeeping gene as an endogenous control.

The cDNA quantities were normalized by measurement of a housekeeping gene as a reference.

A housekeeping point, perhaps, but a major one.

The day of the October attack, Paddock had a room service delivery and a housekeeping call, the hotel said.