The complete coding sequence of blaIMI was further amplified with an additional pair of in-house designed primers, IMI-up (CTGGCACGCATAGTAACCCA) and IMI-dw (ATGCCGAAAGTGCAAGCCT).
PCR products from cDNAs and gDNAs were amplified with primers (Additional file 13), and predicted A-to-I editing sites were validated in available cell lines with the conventional Sanger sequencing.
If no HPV DNA was detected with the primary primer sets, the DNA was then amplified with an additional consensus primer in the E1 gene (Gregoire et al, 1989) and the product sequenced.
When the above mentioned two VPSPr cases, with extreme differences between frontal cortex and cerebellum PrPres patterns, were used to seed PMCA reactions, only the ~19 and ~23 kDa bands present in the cerebellum were amplified with the additional appearance of a band at ~30 kDa.
Additional primers were designed for each taxon to fill in the regions, which did not amplify with standard primers.
The first strand of cDNA was synthesized at 55°C for 30 min and then amplified with the primers (Additional file 4) targeted to isotig 00405 (isogroup 00007).
Amplified RNA from individual embryos was reverse transcribed to cDNA by SuperScript III Reverse Transcriptase (Invitrogen) and amplified with specific primers (Additional file 19: Table S17).
The ABCA1 TSS (−90 to +190) was PCR-amplified with specific primers (Additional file 1: Table S1) in a 25-μl reaction containing 2× RBC SensiZyme Hotstart Taq premix (RBC Bioscience, Taiwan).
Fragments of four transcripts CG3767-RAA, CG16910-RA, CG17934-RA and CG4988-RA) were amplified with specific primers (Additional file 4) and then subcloned into pGEM-T Easy vector (Promega Biosciences, Madison, WI), respectively.
The nrITS (including ITS-1, the 5.8S rRNA gene, and ITS-2) region and three chloroplast fragments (trnV- trnM, rpl- rps and trnL- trnF) were also included and amplified with universal primers (Additional file 8).
cDNA fragments corresponding to the entire coding sequence or selected regions of SPL7 (AT5G18830.1) were amplified with specific oligonucleotides (Additional file 6: Table S1) and cloned into pDONR207 by means of the Gateway BP clonase II (Invitrogen).
