Sentence examples for amplify the expression from inspiring English sources
One, a short stretch of DNA called a CpG oligonucleotide, works with other nearby immune cells to amplify the expression of an activating receptor called OX40 on the surface of the T cells.
In the second simulation, batch effects amplify the expression level differences between the two groups.
Transcription factor genes responding to these signals, concomitantly with their target genes, then have a capacity to specifically amplify the expression of these target genes.
Common viral vectors include herpes simplex virus, recombinant adenoassociated virus, recombinant adenovirus, and adenovirus, used to amplify the expression of targeted genes.
In order to amplify the expression levels from a single locus, we tested seven copies of the enhancer upstream of a single hsp70 promoter.
However, it remains controversial whether inflammatory cytokines are primary or secondary effectors of cartilage damage and defective repair mechanisms in OA since these same pathways also induce or amplify the expression of cytokine genes.
When the team amplified the expression of this gene, memory was further impaired, proving that this stretch of DNA does indeed impact memory.
Chilling stress amplified the expression of the tested CBF3 genes in the P. vulgaris seedlings (Fig. 7a), suggesting a functional similarity of CBFs in P. vulgaris as well as Arabidopsis in response to low-temperature stress (Gilmour et al. 2004; Thomashow 2010).
The following primers were used to amplified the expression constructs from the genomic DNA of K562 cells and cloned into the XhoI and EcoRI site of pcDNA3: miR-320 (forward: ccgaattccaggaaccagacagggacgc; reverse: ccctcgagccgactcttaagtccaggtc) and miR-451 (forward: ccgaattcacagtgcttttcaagccatgc; reverse: ccctcgagatcctcctgccttggcctctg).
Salubrinal also amplified the expression of proinflammatory cytokines and chemokines (but not RANTES) during metabolic stress.
The supplementation of ethanolic extract of c. roseus significantly amplified the expression of GLUT gene mRNA by Real Time PCR in liver of diabetic rats.
