Your English writing platform
Discover LudwigSuggestions(5)
The phrase "amplify potential" is correct and usable in written English.
It can be used in contexts where you want to express the idea of enhancing or increasing someone's or something's capabilities or possibilities.
Example: "Our goal is to create programs that amplify potential in young entrepreneurs, helping them to achieve their dreams."
Alternatives: "enhance potential" or "boost potential".
Exact(6)
The primers based on the recovered ancestral plastomic organization were used to amplify potential nupts.
DNA primers specific to CL14 and CL34 were designed to amplify potential junctions between these two repeats.
This can amplify potential sex differences in sexual desire, making these manifest at their maximum during this peripartum transition across the reproductive years [ 1].
Degenerate primers designed for the reverse transcriptase domain of non-LTR retrotransposable elements in Arabidopsis were used to amplify potential retrotransposons in Drosophila saltans.
The primers described above for the CL14 and CL34 repeats along with a telomeric DNA primer, Tel (5′GTTTAGGGTTTAGGGTTTAG3′), were used to amplify potential junctions between the three different repeats.
To exclude the possibility that the hybrid RNA observed was the result of recombination events at the DNA level between minigene and PTM PCR analysis was conducted with or without reverse transcription and with an extension time sufficient to amplify potential recombination products.
Similar(54)
The Cox proportional-hazards regression model was used to study in a multivariate setting the effect of MYCN status (amplified, not amplified) as potential confounder.
Thus, it was desirable to amplify the potential difference between the two electrodes as a means of determining eye position.
Judge Raggi did not amplify the potential jurors' memories as she brought one person after another to the juror box for questioning.
Our broad collaborations and direct work with policy-makers will amplify our potential to contribute to developing a sustainable aviation system.
In the model, market participants, especially hedge funds, do what they do in real life — seeking profits by aiming for ever higher leverage, borrowing money to amplify the potential gains from their investments.
More suggestions(16)
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com