Sentence examples for amplifies out from inspiring English sources

In "The Flowers," her da-da-dum scatting is so elaborate that it sounds as though it might be a sketch for an instrumental part not yet scored; on "Ode to Divorce," when she sings the line "won't you help a brother out," she stretches and amplifies "out" until it sounds like a trumpet solo.

The state may be maintained without constant energetic input, persists after cell death and even if rare in a cell population a particular sequence may be amplified out from the background by PCR.

But when the hippocampus malfunctions, perhaps emotional pain can be generated and amplified out of context — like Wurtzel's computer program of negativity that keeps running without provocation.

Black's submissive is Hannah Steele Kali Hawkk), a frumpy klutz whose abuse is amplified out of the realm of satire into a weird hinterland of really unfunny gross-out and blaxploitation revenge flick.

Samples whose curves amplified out of the calibrated dynamic range were eliminated.

Lifeact-mEGFP was amplified out of pTH-Ubi-Lifeact-mEGFP using the sense primer GGGGGATCCATGGGTGTCGCAGATTTGAT and the anti-sense primer CACGTCGACTTACTTGTACAGCTCGTCC.

Out of 24 DEGs tested, 21 genes were successfully amplified, out of which 20 validated the microarray gene expression pattern.

Plasmid DNA was prepared using either the respective specific PCR product amplified out of a fecal DNA with the respective primers or matching full-length 16S rRNA genes.

To create the mCherry reporter expressed in yeast, the Thrdx-HA-mCherry and Thrdx-HA-insert-mCherry sequences were amplified out of the pBAD-DEST49 vectors and cloned into the p-ENTR/D-TOPO vector.

The open reading frame of PME1 (Accession no: U49378) from Aspergillus aculeatus [ 47], minus the predicted signal peptide sequence, was PCR amplified out of pYES 2.0 using the forward primer OVEXP3 (5'-CTGCCAATCCACCATAGCCGCCAGCCGTACCACGGCTCC-3') and the reverse primer OVEXP4 (5'-GGC GAATTCTTTAATTAGAAGTAGGAGGTATCGAC-3').

During tapping mode, the nonlinear tip-sample force activates the internal resonance and thereby amplifies the out-of-phase resonant mode.