The phrase "amplified out" is not standard in written English and may cause confusion.
It could be used in contexts discussing sound or signals, but it is not commonly recognized.
Example: "The audio was amplified out to ensure everyone could hear the presentation clearly."
Alternatives: "boosted" or "enhanced".
The state may be maintained without constant energetic input, persists after cell death and even if rare in a cell population a particular sequence may be amplified out from the background by PCR.
But when the hippocampus malfunctions, perhaps emotional pain can be generated and amplified out of context — like Wurtzel's computer program of negativity that keeps running without provocation.
Black's submissive is Hannah Steele Kali Hawkk), a frumpy klutz whose abuse is amplified out of the realm of satire into a weird hinterland of really unfunny gross-out and blaxploitation revenge flick.
Samples whose curves amplified out of the calibrated dynamic range were eliminated.
Lifeact-mEGFP was amplified out of pTH-Ubi-Lifeact-mEGFP using the sense primer GGGGGATCCATGGGTGTCGCAGATTTGAT and the anti-sense primer CACGTCGACTTACTTGTACAGCTCGTCC.
Out of 24 DEGs tested, 21 genes were successfully amplified, out of which 20 validated the microarray gene expression pattern.
In "The Flowers," her da-da-dum scatting is so elaborate that it sounds as though it might be a sketch for an instrumental part not yet scored; on "Ode to Divorce," when she sings the line "won't you help a brother out," she stretches and amplifies "out" until it sounds like a trumpet solo.
Since relatively large amounts of titrant (0.1 mL of 0.1029 mol.L−1 HCl) were used in the present titration studies, slow pH stabilization processes seem to be amplified and out-of-equilibrium states became easily measurable.
At one point, a chant broke out, amplified by several former Sanders supporters in the room: "I believe that she will win".
That uncertainty will by amplified by an "out" vote because no-one's entirely sure what a Britain outside of the EU will look like and how it will relate to its neighbours.
Which is the best way to enter?" Once we've made our way into the quarantined world of Sunderland, with its rain and fog, its snow "swirling hypnotically," which the wind "snaps... down the lane like a woman shaking the wrinkles out of sheets," the destinies of the characters crisscross and play themselves out, amplified by twists of fate and uncomfortable revelations.
