Sentence examples for amplification master from inspiring English sources

To amplify genomic DNA, 7.5 µl of 10× Amplification Master Mix, 47.5 µl of Nuclease-free Water and 5 µl of Jumpstart Taq DNA polymerase were added and heated at 95°C for 3 min, then 14 cycles of two-temperature amplification was employed at 94°C for 15 sec and 65°C for 5 min using a PCR Thermal Cycler DICE (TaKaRa).

After a 10-min incubation on ice, Stop Solution was added, followed by the amplification master mix.

Amplification was performed by adding 7.5 μL of 10 × Amplification Master Mix, 48.5 μL of nuclease-free water and 5 μL WGA DNA polymerase.

23 μl amplification master mix and 2 μl beads were mixed denatured at 95°C for 30 seconds and cycled as follows: 30 seconds at 95°C, 30 seconds at 55°C, 30 seconds at 72°C for 16 cycles.

The amplification master mixture contained 2X PCR Amplification Buffer, 2X Enhancer Buffer, 300 μM dNTPs mix, 1mM MgSO450nM0nM of reverse Illumina adapter primer, and 7.5 units of Platinum Pfx DNA polymerase (Invitrogen; cat. no. 11708-039).

An amplification master mix was assembled, consisting of 5 μl 5× HF buffer (Finnzymes), 10 μl sterile deionised water, 5 μl dNTP mix (2 mM/dNTP), 1 μl 10 pmol/μl RDV primer (AACTGCCCCGGGTTCCTCATTCTCT, MWG-Biotech), 1 μl 10 pmol/μl LAmpFDV (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT, MWG-Biotech) and 1 μl 2 U/μl Phusion polymerase (Finnzymes).

cDNA was diluted four times and 1.25  μl of each sample was preamplified using 2.5  μl of 2x Taqman pre-amplification master mix (Applied Biosystems, Waltham, MA, USA) and 1.25  μl of the primer pool (0.2 pmol each primer/ μl).

Pre-amplification was performed in 5 μL, containing 2.5 μl Pre-amplification Master mix (Applied Biosystems), 1.25 μl of 96 Markers Primer mix and 1.25 μl DNA at 5 ng/μL (90 panel samples, positive control: genomic Duck DNA, negative control: genomic Hamster DNA, blank control: H2O ).

The next step involved library amplification using HiFi Library Amplification master mix (Kapa biosystems, MA) and BpmI-primer (CCGGCCCTGGAGTGTTGGGTGTGTTTGG).

Fragments of 230 250 bp (with indices and adaptors) were isolated using a Gel Extraction Kit (Qiagen) and subjected to PCR amplification with Phusion Master Mix (NEB) and Solexa Amplification primer mix (Illumina, Inc., San Diego, CA, USA) to add barcode 2 according to the Illumina sample preparation guide.

Fragments of 400 450 bp (with indices and adaptors) were isolated using a Gel Extraction Kit (Qiagen) and subjected to PCR amplification with Phusion Master Mix (NEB) and Solexa Amplification primer mix (Illumina, Inc., San Diego, CA, USA) to add barcode 2 according to the Illumina sample preparation guide.