Sentence examples for amount carried out from inspiring English sources

The phrase "amount carried out" is not correct and may cause confusion in written English.
It is unclear in meaning and does not convey a specific idea without additional context.
Example: "The amount carried out during the experiment was recorded for analysis."
Alternatives: "quantity executed" or "total completed".

Exact(1)

Theresa May, the Home Secretary, is expected to bring forward proposals to limit the amount carried out.

Similar(58)

Evaluation of β-actin expression, used as control of the RNA amount, was carried out by using the forward primer sequence CAGAGCAAGAGAGGCATCCT and the reverse primer sequence TTGAAGGTCTCAAACATGAT corresponding to residues 216 235 and residues 405 424, respectively, which yield a 201-bp product.

Measurements of relative nuclear DNA amounts were carried out as described in Miyashita et al. (2011).

With regard to management and cost-effectiveness, it was stated that the total cost was too low for the amount of work carried out by the Programme.

The substantial amount of research carried out on FDI attacks can be classified into three categories.

The aim is to limit the amount of "sexting" carried out by teenagers.

The small amount of work carried out on heat transfer in CFB combustors is reviewed.

Despite the large amount of work carried out in this area, deformable models still suffer from a number of drawbacks.

Sorption has advanced very much due to the immense amount of research carried out around heat pumping and solar refrigeration.

In the case of high plasticity clays, despite the large amount of research carried out, soil microstructure and its evolution along mechanical and hydraulic paths are still not well understood.

To date there has been a considerable amount of work carried out on two-dimensional laser forming, using multi-pass straight line scan strategies to produce a reasonably controlled bend angle in a number of materials, including aerospace alloys.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: