Sentence examples for am buffer from inspiring English sources

Re-suspend the cell pellet in 20 ml of the AM buffer containing [30 mM NaOAc (pH5.1), 10 mM MgCl2] and add an equal volume of phenol saturated with the same AM buffer.

Collect cells by centrifugation at 4000 g for 45 min at 4°C, re-suspend them in 10 ml of [10 mM Tris-HCl (pH 7.5) with 100 mM NaCl] in Falcon tube and pellet by centrifugation at 4000 g for 20 min. Re-suspend the cell pellet in 20 ml of the AM buffer containing [30 mM NaOAc (pH5.1), 10 mM MgCl2] and add an equal volume of phenol saturated with the same AM buffer.

Amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM labelled forward primer (GAGTCCCTCAAGTCCTTCCAGCA) and reverse primer (GCCCAAACTCACGGTCGGT) in 10 µl reactions containing: 0.2 mM dNTPs; 10% DMSO; AM buffer (67 mM Tris-HCL pH 8.8; 16.6 mM (NH4 S04; 2 mM MgCl2; 0.17 mg/ml BSA) and 0.5U AmpliTaq DNA polymerase (Applied Biosystems).

Amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM labelled forward primer (GAGTCCCTCAAGTCCTTCCAGCA) and reverse primer (GCCCAAACTCACGGTCGGT) in 10 µl reactions containing: 0.2 mM dNTPs; 10% DMSO; AM buffer (67 mM TrisHCL pH 8.8; 16.6 mM (NH4 S04; 2 mM MgCl2; 0.17 mg/ml BSA) and 0.5 U AmpliTaq DNA polymerase (Applied Biosystems).

Amplification of the CAG repeat from R6/2 mouse DNA was performed with a FAM-labelled forward primer (GAGTCCCTCAAGTCCTTCCAGCA) and reverse primer (GCCCAAACTCACGGTCGGT) in 10 µl reactions containing: 0.2 m m dNTPs; 10% DMSO; AM buffer (67 m m Tris HCl pH 8.8; 16.6 m m (NH4 SO4; 2 m m MgCl2; 0.17 mg/ml BSA) and 0.5 U AmpliTaq DNA polymerase (Applied Biosystems).

Fifteen feet might have been buffer zone enough.

"Mangrove forests are buffer belts that reduce the magnitude of sea tides to the delta floodplains".

The reality is the Europeans know that Ukraine and Georgia are buffer states for Russia.

What the "Who was buffer?" listicles of 80s action stars overlook is the quieter assumption of who was more human.

The second social media management tool is buffer, although I have not used it for myself, I use buffer for some clients and it is a great tool!

Spectra were buffer corrected.