Sentence examples for alternatively by using the from inspiring English sources

The paper presents a comparative study between symmetric and asymmetric straggle architecture, where asymmetric nature is observed by considering straggle in source and drain side alternatively by using the data obtained from 2D numerical simulator Sentaurus TCAD.

Alternatively, by using the S100A4 promoter to disrupt TGFβ signalling, we have targeted a unique DC population with specific functional properties or a specific stage of DC maturation.

Alternatively, by using the Porath plot and our current SEC data, we have found the hydrodynamic radius (Stokes radius) of high molecular mass AβOs to be 4.8 nm, assuming a globular-shape-like behavior of this assembly in solution.

Because of the excessively large number of input variables available, and the lack of any automated procedure for variable selection, it was decided to reduce the number of inputs to the neural network models by taking principal components of the 20 variables and alternatively by using the variable combinations that had been selected in the corresponding discriminant analyses.

Some cheats can alternatively be unlocked by using the Perfect Dark Game Boy Color game and Transfer Pak.

A 145-bp segment outside the alternatively spliced region was amplified by using the primers TERT F1784 (CGGAAGAGTGTCTGGAGCAA) and TERT R1928 (GGATGAAGCGGAGTCTGGA), and alternative splice products of the TERT transcript were amplified by using the primers TERT F2164 (GCCTGAGCTGTACTTTGTCAA) and TERT R2620 (CGCAAACAGCTTGTTCTCCATGTC) as described (Ulaner et al, 1998).

Alternatively, bacteria could be excluded by using the fluorescence triggering in the FL2 or FL3 channel.

Alternatively, toggle the tool on by using the keyboard shortcut "Ctrl+O" or "Cmd+O .. Resize the Artboard by dragging the handles on the Artboard's outline.

Alternatively, total polyphenols may be measured by using the Folin-Ciocalteu colorimetric assay, which provides crude estimates of polyphenol contents in foods.

Alternatively, you can block the user by using the following URL: www.myspace.com/469057408/index.cfm?fuseaction=block.blockUser&userID=.blockUser&userID=

Alternatively, the evaporation time can be reduced by using the optional evaporation flask.