The phrase "alternatively amplified" is correct and usable in written English.
It can be used in contexts where you are presenting an alternative method or approach that enhances or increases something.
Example: "The sound system can be alternatively amplified using a different set of speakers for better acoustics."
Alternatives: "enhanced in another way" or "increased through an alternative method."
Alternatively, PCR products amplified with carboxyfluorescein (FAM) labeled forward primers were analysed by capillary electrophoresis, where AS was detected as a size difference of three nucleotides in length.
We selected primers of which both the normal and the alternatively spliced variant were amplified by the same PCR reaction.
A 145-bp segment outside the alternatively spliced region was amplified by using the primers TERT F1784 (CGGAAGAGTGTCTGGAGCAA) and TERT R1928 (GGATGAAGCGGAGTCTGGA), and alternative splice products of the TERT transcript were amplified by using the primers TERT F2164 (GCCTGAGCTGTACTTTGTCAA) and TERT R2620 (CGCAAACAGCTTGTTCTCCATGTC) as described (Ulaner et al, 1998).
RNA analysis was carried out by RT-PCR using primers that amplify alternatively spliced forms of JCV early transcripts (Fig. 2A).
Alternatively, bacteria can amplify stochastic processes within the cell to exhibit different gene expression profiles [ 6], enabling survival under stressful environments [ 7].
Alternatively, ipilimumab may amplify immune adaptation through shifting T-cell responses, a mechanism for overcoming immune tolerance that has been observed in a long-term survivor of metastatic melanoma in the absence of immunotherapy (Yamshchikov et al, 2005).
Alternatively, AtSTT3A promoter sequences were amplified into pBluescript vector and the site-directed mutagenesis was performed to create an Afl II site which permits cDNA sequences of SaSTT3A and SaSTT3B being cloned into the vector between it and NheI sitse.
To generate antibodies reactive to both isoforms (panSYT), the 5' half of SYT cDNA, upstream of the alternatively spliced exon 8, was amplified with the primers (Figure S6) and subcloned into pGEX-KG and transformed into BL-21 competent cells (Stratagene, La Jolla CA).
Alternatively, a dispersal signal maybe amplified in a closed system.
Alternatively, is the region 13q.13.3 amplified in DLD1+13?
