The phrase "altered nucleotide" is correct and usable in written English.
It can be used in contexts related to genetics, molecular biology, or biochemistry when discussing modifications to nucleotides in DNA or RNA.
Example: "The study focused on the effects of altered nucleotides on gene expression and protein synthesis."
Alternatives: "modified nucleotide" or "changed nucleotide".
On the other hand, all promoter sequences derived from JPU strain had at least one altered nucleotide, with the exception of P ADH1, which featured six nucleotide differences and two deletions (Table 3).
The analyses of cloned HCV RNA also showed that although the nucleotide sequence spanning codons 85 87 was not altered, nucleotide changes at position 317 (CC to AT) resulted in a conformational change of the RNA structure that shifts AUG-85 from a stem into an internal loop.
Epigenetics are changes in gene expression which are not a result of altered nucleotide sequence [ 25].
However, significantly altered nucleotide usage in the positive correlation trend population was not observed.
An additional source of p53 activation in RP-deficient cells might arise from the altered nucleotide metabolism (Fig. 3).
Mutant oligonucleotide (with the altered nucleotide underlined) was used to change glutamic acid at position 359 to a lysine (E359K, 5' - TGG GTA GCC CCC AAA GCT CTG CAG AAG - 3') within the kinase domain (16).
Insertion and deletion events do not appear to produce obvious junction sites with altered nucleotides.
The analysed viruses were highly similar (overall identities between 91.9% and 99.8%), but there were clear differences in the number of altered nucleotides between the genes.
In the nervous system Rab7a controls endosomal trafficking and signaling of nerve growth factor receptors [26,27], and mutant Rab7a proteins causing CMT2B have altered nucleotides Koff, inhibit neurite outgrowth and alter neurotrophin trafficking and signaling [28 33].
Owing to 3' end modification [ 12, 15- 18], the altered nucleotides at the 3' end of reads may cause mismatches at the mapping procedure, making the originally perfect match reads fail to be mapped back to miRNAs.
To facilitate cloning into the NdeI and XhoI sites of expression vector pET15b (Novagen), primers were designed to incorporate an NdeI site at the initiating methionine codon CP25L_NDE (5'-GAATGT CA TalteredTAAATCAATCA-3', altered nucleotides underlined throughout) and a XhoI site downstream of the stop codon CP25L_XHO (5'-A CTC GAGGTGGGATAATTCTCACTC3').
