Sentence examples for also used for sampling from inspiring English sources

Suggestions(1)

The phrase "also used for sampling" is correct and usable in written English.
It can be used when describing an item, method, or tool that serves multiple purposes, one of which is sampling.
Example: "This device is versatile and is also used for sampling various environmental conditions."
Alternatives: "additionally utilized for sampling" or "further employed for sampling".

Exact(2)

Sticky traps were also used for sampling indoor active sand flies.

After starting with an initial value in the range of 1 5, we switch to a smaller value of about 0.05 which is then also used for sampling.

Similar(58)

This protocol was also used for samples from C. carpio var.

Test-retest metrics that are directly derived from the random ANOVA model (WSCV, ICC, and RC) can be also used for sample size calculation when planning a study that involves multiple PET scans per subject.

This buffer was also used for sample dilution.

Dynamic programming algorithm backtraces are also used for random sampling, where the score for each possible backtrace path is deemed to be (proportional to) the probability of the path, and it is desired to choose a path according to that probability distribution.

This access was also used for arterial blood sampling.

The above method was also used for other samples as shown in Table 9.

The trnH-psbA intergenic spacer was amplified using the primers psbA-F and trnH-R [56]; sequencing reactions were performed with PCR primers, but the following taxon-specific primers were also used for some samples: trnH-Rn1 (GGACGTGAACRAGATCTATC) mostly for Pteridaceae, psbA-Fn1 (CGTCTGGTTATGCAGCACAA) and trnH-Rn2 (CCTTGATCCACTTGGCTACG) both mainly for Dryopteridaceae.

Analysis of leukocyte counts was performed in EDTA anticoagulated blood using routine analysis methods also used for patient samples (flow cytometric analysis on a Sysmex XE-5000 (Etten-Leur, The Netherlands)).

The mean arterial pressure (MAP) was measured through cannulation of the right carotid artery (Sirecust 730, Siemens, Solna, Sweden), which was also used for collecting samples for arterial blood gas analysis (Blood Gas Analyzer, Siemens Bayer 865, Siemens).

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: