The phrase "also for injection" is correct and usable in written English.
It can be used in contexts where you are specifying that something is suitable for injection, such as in medical or pharmaceutical discussions.
Example: "This medication is available in tablet form, but it is also for injection if needed."
Alternatives: "suitable for injection" or "intended for injection".
Negative control morpholino (5′- CCTCTTACCTCAGTTACAATTTATA -3') was also injected for injection control.
In almost one-half of patients, PICCs were also used for injection of contrast medium during computed tomography scans.
Guar gum solutions exhibit peculiar shear thinning properties, with high viscosity in static conditions and lower viscosity in dynamic conditions: this is beneficial both for the storage of MZVI dispersions, and also for the injection in porous media.
Nanofabrication using nanopipettes can be employed not only for the deposition of metals but also for the injection of biomolecules such as DNA and proteins [56, 57].
The catheters were used for several purposes such as administration of fluid and medications; in 40 patients, they were used also for power injection of contrast medium during radiologic exams.
Assuming that this holds also for the injection of high amounts of insulin, the assay of Desbuquois et al. overestimates insulin concentrations at later points in time.
He also developed procedures for injection molding low-cost sensor interfaces for medical fluid tubing.
Mesna was obtained from Sigma (St Louis, MO, USA) and was also dissolved in water for injection to obtain a concentration of 200 mg ml−1.
However, because κ* is also an injection for (G, h -invariant h -invariantorms, thorizontals such a right-inverse r that r ∘ κ* is the identity mapping formsorizonthereorms on M, i.exists∘ κ* = P τ holdsuch
The study investigators also assessed the treatment area for injection site reactions at the scheduled clinic visits.
