Sentence examples for almost the same sequences from inspiring English sources

Suggestions(1)

The phrase "almost the same sequences" is correct and usable in written English.
It can be used when comparing two or more sequences that are very similar but not identical.
Example: "The DNA samples from the two species show almost the same sequences, indicating a close evolutionary relationship."
Alternatives: "nearly identical sequences" or "similar sequences".

Exact(1)

AP2, ZID and GATA-2 motifs appeared to have almost the same sequences or reverse complementary chains, MyoD and GATA-1 motifs were also similar.

Similar(59)

A notable example is a ProcM analogue from Prochlorococcus MIT9303, which has almost the same sequence as ProcM (95% identity, 97% similarity).

However, only one gene in the A2 subgroup was obtained from the cloning experiments, suggesting that NbMAPKKKγ homologous gene(s), which carries almost the same sequence as NbMAPKKKγ itself, must be effectively knocked down in TRV- NbMAPKKKγ-infected plants.

Despite having almost the same sequence, these probes were retained in the initial design since it was unclear how similar fish from the European lineage would be to those from the sequenced lineage (North American), and base pair differences can impact the binding affinity depending on the location of the mismatch [ 13].

When they didn't throw inside, they changed speeds and locations constantly, almost never throwing the same sequence.

When we characterized the strains in this study by MLST we found that almost all of them shared the same sequence type as Houston-1 (8 ).

However, because almost all miR399 genes have the same sequence in the first 10 nt that are the key for miRNA function, it is difficult to judge which miRNA is responsible for cleavage at each target site, especially at positions 10 11 relative to the 5′ end of the miRNA.

We also checked that miR-103 and miR-107 have almost the same mature sequences: mmu-miR-103: AGCAGCAUUGUACAGGGCUAUGA mmu-miR-107: AGCAGCAUUGUACAGGGCUAUCA After the pair (mmu-let-7b, GCNF) was well validated by our CKE model, we observed mmu-let-7g, and mmu-let-7i are in the same cluster as mmu-let-7b (see Figure 5, top right).

They largely share the same sequence of notes.

In unison, they clapped back the same sequence.

The incompatibilities with wild-type were almost the same between mutant sequences.

Show more...

Ludwig, your English writing platform

Write better and faster with AI suggestions while staying true to your unique style.

Student

Used by millions of students, scientific researchers, professional translators and editors from all over the world!

MitStanfordHarvardAustralian Nationa UniversityNanyangOxford

Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak quote

Justyna Jupowicz-Kozak

CEO of Professional Science Editing for Scientists @ prosciediting.com

Get started for free

Unlock your writing potential with Ludwig

Letters

Most frequent sentences: