The phrase "almost the same sequences" is correct and usable in written English.
It can be used when comparing two or more sequences that are very similar but not identical.
Example: "The DNA samples from the two species show almost the same sequences, indicating a close evolutionary relationship."
Alternatives: "nearly identical sequences" or "similar sequences".
A notable example is a ProcM analogue from Prochlorococcus MIT9303, which has almost the same sequence as ProcM (95% identity, 97% similarity).
However, only one gene in the A2 subgroup was obtained from the cloning experiments, suggesting that NbMAPKKKγ homologous gene(s), which carries almost the same sequence as NbMAPKKKγ itself, must be effectively knocked down in TRV- NbMAPKKKγ-infected plants.
Despite having almost the same sequence, these probes were retained in the initial design since it was unclear how similar fish from the European lineage would be to those from the sequenced lineage (North American), and base pair differences can impact the binding affinity depending on the location of the mismatch [ 13].
When they didn't throw inside, they changed speeds and locations constantly, almost never throwing the same sequence.
When we characterized the strains in this study by MLST we found that almost all of them shared the same sequence type as Houston-1 (8 ).
However, because almost all miR399 genes have the same sequence in the first 10 nt that are the key for miRNA function, it is difficult to judge which miRNA is responsible for cleavage at each target site, especially at positions 10 11 relative to the 5′ end of the miRNA.
We also checked that miR-103 and miR-107 have almost the same mature sequences: mmu-miR-103: AGCAGCAUUGUACAGGGCUAUGA mmu-miR-107: AGCAGCAUUGUACAGGGCUAUCA After the pair (mmu-let-7b, GCNF) was well validated by our CKE model, we observed mmu-let-7g, and mmu-let-7i are in the same cluster as mmu-let-7b (see Figure 5, top right).
The incompatibilities with wild-type were almost the same between mutant sequences.
