Sentence examples for all inserts to from inspiring English sources

Subsequent BLASTn analyses of the individual predicted genes as well as the whole-insert sequences suggested all inserts to be derived from bacteria.

Whole CS applied at a single concentration to the Vitrocell® 24/48 system (0.5 L/min) reduced WST-1 in all culture inserts to a similar level, providing the first evidence that the distribution of CS was uniform in the exposure system.

These objects appear similar to those identified by the PNG IMR during the National HIV Mapping project.e Unlike penile cutting practices, respondents had not heard of a 'cutter' or 'operator' carrying out this practice on others: all inserts appeared to be inserted by the individual.

All inserts were sequenced to confirm identity to original sequences.

To repair a table: To repair a table: If the repair doesn't work, you may need to delete the table and restore from the backup file: If the repair doesn't work, you may need to delete the table and restore from the backup file: The backup file contains all INSERT commands to restore all tables you specified when you made the backup.

All inserts were confirmed to be in-frame and full length by sequencing.

All inserts were sequenced to confirm that the nucleotides at rs6661009 and rs11265251 were the only differences introduced between the two SLC39A1 and TPM3 constructs, respectively.

Duplicate filters were hybridized with three different sets of probes: a pool of oligonucleotides corresponding to transcripts seen six or more times in the initial sequencing, a pool corresponding to transcripts seen four or five times, and, to monitor PCR yield, a control oligonucleotide probe internal to the primers used to amplify clone inserts but common to all inserts (AAAGACAAAACATGTCGGCC).

This ensured that all needles were inserted to the same depth of 10 mm.

All screws were inserted to identical depths using a consistent depth gauge, and radiological examinations were performed to check the implanted screw depths.

The hair pin sequence was determined by searching for the miR-30 context and the miR-30 loop that are common to all inserts and frame the hair pin.