We pay particular attention to the alignment of design features of the games, the standards to which developers intended to align their games, and assessments of specific mathematics skills.
For finding out the exact position and possible role of the amino acids at the uniquely mutated position in a 3D structure of VP28, we performed the alignment of the designed and representative VP28 protein from Bangladesh over the reference protein from PDB consisting of different amino acid other than that was found for the first time in Bangladesh.
NGSView is an extension of DNPTrapper (Arner et al., 2006), our previously developed alignment editor designed for analysis of Sanger reads from complex repeat regions.
To verify that the repetitive sequence in the HLE centromere corresponded to the SVA_A element identified by the human gibbon alignment, we designed two sets of PCR primers (SVA_L1+R1 and SVA_L2 + SVA_R2) based on the sequence found in CH271-340F4 (supplementabletable S1, Supplementary Material online).
Deleting the two unnecessary fragments the resected tumor and the unused part of the healthy hemipelvis by selecting them on the Object Tree and pressing Delete on the keyboard, we can appreciate the excellent alignment of the newly designed custom implant (beige) in relation to the diseased hemipelvis (black) (Fig. 25).
This paper points out a major step forward in software interoperability and the alignment of digital design applications, allowing users to engage with morphological form-finding enriched by real-time physical building performance feedback.
Perceptions from internal (within institution) and external (external to institution) stakeholders can be sought to inform the nature of the training process as well as relevance and alignment of curricula design to national priorities.
Given the high similarity in the flanking regions of new introns for most retro-parental alignments, we designed pairs of primers whose products (Additional file 9) spanned the intronic regions for both the retrogenes and their parental genes.
Therefore a LFA can be used to design and guide trauma registry project management, to integrate the cultural, clinical and capacity variations among countries; and to ensure early alignment of the project's design and evaluation.
We used previous genomic sequence alignment of Route66 to design primers for its PCR amplification (Forward primer: 5'ACGCCGGAGTAGACCTCGTT3', Reverse primer: 5'ATATGCCATCTGTGGATATCC3').
