The phrase "alignment of design" is correct and usable in written English.
It can be used when discussing how different elements of a design are coordinated or fit together harmoniously.
Example: "The alignment of design in this project ensures that all components work together seamlessly to create a cohesive final product."
Alternatives: "design coherence" or "design harmony".
Since the pairwise potential in the Z-score design tends to weaken the conservation caused by function, functionally conserved sites tend to have a large conservation difference between the native alignment and the alignment of designed sequences.
This paper points out a major step forward in software interoperability and the alignment of digital design applications, allowing users to engage with morphological form-finding enriched by real-time physical building performance feedback.
Perceptions from internal (within institution) and external (external to institution) stakeholders can be sought to inform the nature of the training process as well as relevance and alignment of curricula design to national priorities.
For finding out the exact position and possible role of the amino acids at the uniquely mutated position in a 3D structure of VP28, we performed the alignment of the designed and representative VP28 protein from Bangladesh over the reference protein from PDB consisting of different amino acid other than that was found for the first time in Bangladesh.
Although a single case of compound alignment, in terms of design values utilization, was examined, the research revealed an extensive area of SSD inadequacy, where AASHTO 2011 design guidelines fail to guarantee safety during emergency vehicle braking.
Quality function deployment (QFD) is an integrated decision-making methodology that can assure and improve the alignment of elements of design and construction processes with the requirements of customers.
And when you find a pair of gorgeous heels that are also, by a wondrous alignment of nature and design, actually comfortable – well, that is the joy of joys, the holy grail of shoe shopping, the ultimate sartorial triumph.
We used previous genomic sequence alignment of Route66 to design primers for its PCR amplification (Forward primer: 5'ACGCCGGAGTAGACCTCGTT3', Reverse primer: 5'ATATGCCATCTGTGGATATCC3').
FMY and ODA designed CP primers, ARA, NB, EJC, KRD, JH, HH, NH, DT, DMT, CT, and WZ performed PCR amplification, purification of amplicons and their submission for sequencing, alignment of sequences and design of GSPs; ODA, DCD, and CCC sequenced PCR amplicons.
Deleting the two unnecessary fragments the resected tumor and the unused part of the healthy hemipelvis by selecting them on the Object Tree and pressing Delete on the keyboard, we can appreciate the excellent alignment of the newly designed custom implant (beige) in relation to the diseased hemipelvis (black) (Fig. 25).
