Companies that can align themselves with this shift -- with new technologies and services in energy, efficiency, material science, logistics, building controls, transportation, big data, and much, much more -- will find rapidly growing, multi-trillion-dollar markets and funding.
"This action, difficult as it is, reflects an assessment of the marketplace that is conservative, and more aligned with the shift in customer demand," Mr. Ford wrote in the e-mail to employees.
We confirmed the likely location of the replication terminus by identifying a single dif sequence (ACTTTGTATAATATATATTATGTAAACT, position 1 449 088 to 1 449 115) that aligns with the shift in GC skew (Fig. 1B).
This shift in the professionals' focus aligns with the shifting awareness of the consumer for toxin-free food, products, and environment," the architect points out.
The parameters (φ, θ, ψ, x, y) of all experimental particles from the conventional SPA procedure are transformed according to the model shift, to make all particle aligned with the shifted model, thereby yielding the preliminary parameters of the target module for every experimental image.
For the first two decades of relations, Washington had strategic reasons to align with Beijing and shift the balance of power against the Soviet Union.
"With this shift, economic development is broken".
With this shift, value changed.
I think their findings align with similar shifts in the larger culture: an evolution in all sectors of society and in individual lives today -- again, towards heightened collaboration, connection, emotional attunement to others, and diverse interdependence.
Do you align with this description of "nice"?
You can see how it works here and get a sense of how well the project aligns with a shift away from consumerist culture.
