Your English writing platform
Discover LudwigSuggestions(2)
Exact(5)
The Dream Is Over opens with a screed against band life called If This Tour Doesn't Kill You, I Will.
On Wednesday, the state filed charges against band members who are accused of fatally beating a fellow student, Robert Champion, 26, in a hazing ritual after a football game in November.
In June Hilton alleged that he was assaulted by a manager of the band Black Eyed Peas; video of the incident revealed Hilton using an anti-gay slur against band member will.i.am.am
The primary antibodies against Band 3 (provided by Dr. Barry Paw) were diluted to 1∶10,000 in 5% BSA.
PCR was then conducted with primers against Band 3 (forward: 5'- ACTGGACCTGCAAAGCCAAG, reverse: 5'- CCACAATGACGATCAGCCAC) and the control, 18S (forward: 5'- cacttgtccctctaagaagttgca, reverse: 5'- ggttgattccgataacgaacga).
Similar(54)
Righteousness grows more tuneful with every album by Rise Against, a band from Chicago that started blasting in 1999.
A dreamy experimental-pop band that pushes against band-ness, Stars Like Fleas makes songs that sound, at best, as if they fell out of the sky in random but concordant patterns.
Egypt has also bought submarines and fighter jets, which are of limited use against bands of extremists.
"People who are getting music for free off the internet have a hard time arguing against bands selling their songs to commercials," Marks says.
Some of the members succeeded admirably, as is seen in a modernist vase from 1915 by Sara Galner depicting an abstract landscape of dark trees and white flowers against bands of sand, blue sky and white clouds.
Despite being embroiled in the American Civil War, the United States Army retaliated in 1863 and 1864, even against bands which had not been involved in the hostilities.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com