Your English writing platform
Discover LudwigSuggestions(5)
The phrase "again with the second" is correct and usable in written English.
It can be used when referring to a repeated action or situation involving a second item or instance.
Example: "I can't believe we're having this discussion again with the second proposal; we just went over this last week."
Alternatives: "once more with the second" or "here we go again with the second".
Exact(7)
Stokes struck again with the second ball of his third over, ending a brilliant 151 by Phil Jaques, and although it took until tea to complete the job, with Stokes, Chris Rushworth and leg-spinning all-rounder Scott Borthwick taking three wickets each, Durham were left with 38 overs to score 121 for victory.
It bends upward again with the second industrial revolution of the late 1800s built on the internal combustion engine, electricity and telephony.
Back again, with the second (and hopefully useful) part of my diatribe on interpersonal communication, and why lack of it has made graduate school difficult for a great many of us.
RJD2, aka Ramble Jon Krohn, previously shared the lead single, "Peace of What," and now he's turning heads again with the second single, "The Sheboygan Left".
Mutation of A's in either motif of WB6 that are also present in RD6 (consensus sequence) to C's significantly impaired PhoP binding (WB6m6 and WB6m7), again with the second motif having a milder effect.
The digested DNA was purified with phenol chloroform and ethanol precipitations and ligated again with the second linkers (50 μM), which were prepared from the two oligonucleotides 5′ATGGTACCACCCGTAGGCCCTAC CGGT ACC -3′ and 5′-GGTACCGGTAGGGCCTACGGGTGGTACCAT -3′ (Sigma, Singapore).
Similar(52)
The opposition did it again with the first round of the presidential election last month.
But after meeting again with the first pathologist, James Traylor, he felt confident about the theory of smothering.
And it just happened to me again with 'The First Wives Club.' The movie made a hundred million dollars, and the studio couldn't get a sequel together.
Later that night, he phoned again – with the first public statement that he believed there was no longer a place for non-violent resistance to apartheid.
Halfway through the performance I accidentally shut down the app with my earlobe; rebooted, the soundtrack began again with the first story, at odds with what everyone else was hearing.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com