Sentence examples for after synthesizing from inspiring English sources

After synthesizing information gathered from the script and production meetings, the sound designer begins the actual work of creating, recording, and editing the music and effects that make up the production's sound design.

After synthesizing their new COF, Yaghi, Chang, and their colleagues placed a layer atop an electrode.

The first day of analyses (March 24th) was shortly after synthesizing, mounting, and polishing the materials.

Immediately after synthesizing the nanowire bundles, the resistance of the CNT bundles was approximately 5 kΩ.

To facilitate catalytic activity, caffeic acid was removed by centrifugation after synthesizing CA-AuNPs.

After synthesizing CNTs, the reactor was turned off and cooled down to room temperature under Ar gas atmosphere.

After synthesized in 1814, Paris green was reported for a large import as a light and bright green pigment to paint architectures in China from the late 19th century.

The proteins can be thought to reach their positions in a cell automatically after synthesized.

After synthesized, sucrose will be loaded into phloem and transported to sink tissues (stem and/or panicle).

After synthesized at Biosune (Shanghai, China), the gene was amplified using a specific primer pair (Forward: CATG CCATGGCTATGAGCGCCGAAAAACAGAAGTATG; Reverse: CCC AAGCTTGATAATCGATAGGGTCGCGAACAATG) to generate the digestion sites of endonucleases NcoI and HindIII (italics).

In this regard, after synthesize and characterizations of PGS, PGS-PCL and gelatin fibrous scaffolds were separately developed in order to optimize the electrospinning parameters.