Your English writing platform
Free sign upThe phrase "advanced expression" is correct and commonly used in written English.
It typically refers to a complex or sophisticated way of communicating an idea or emotion. You can use it in a sentence like this: "Although he was only 15 years old, Robert impressed everyone with his advanced expression of his thoughts and feelings during the debate."
Exact(6)
Who would have thought that the most advanced expression of the New Deal philosophy would be one of Hearn's notions?
Published in the open-access journal PLOS ONE, the study combined advanced expression profiling and systems biology analysis to both identify genes affected by relaxation response practice and to determine the potential biological relevance of those changes.
Buñuel's understanding of Surrealism approaches Adorno's conception of the avant-garde as an advanced expression of bourgeois art.
One individual with decision-making capacity and Motor Neurone Disease, had made an advanced expression of treatment preference regarding Percutaneous Endoscopic Gastrostomy.
Selection for integration of the pRetroX-Tet-On Advanced expression plasmid was performed with G418 (500 μg/ml, Life Technologies) for 7 days.
To generate a regulated INPP4B expression construct for stable transfection, 3xFLAG-INPP4B wamplifiedied by PCR (forward, 5'- GandAGCTTGCGGCCGCAGAAATTAAAGAGGAAGGGGC-3' and reverse 5'- GATGAATTCGCGGCCGCTTAGGTGTCAxGCTTTTCCATAAGTC-3') and cloned into the NotI site of the pLVX-Tight-Puro vector of the Tet-On Advanced expression system (Clontech) to generate pLVX-Tight-Puro FLAG-INPP4B.
Similar(54)
It was like oxygen to observe the ease with which Balanchine circulated through time, music, styles and sources, remaining firmly within the tradition of classical ballet while extending it toward the most advanced expressions of theatrical art to be seen on any American stage.
There was a significant reduction in advanced glycation, expression of the receptor of the glycated products and oxidative stress markers.
More advanced temporal expression taggers, such as Heideltime [16] may be used in place of our method for Spanish text, but are currently not available in Portuguese.
Notwithstanding these obstacles, the demand for advanced glycoprotein expression platforms has fueled different glycoengineering approaches.
Therefore, improving the capacity for efficient and advanced antibody expression is conducive to cutting the costs.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.
Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com