Sentence examples for adjacent matching from inspiring English sources

Each tumour sample was accompanied by adjacent matching normal tissues.

Urban hh: At the interim assessment, 50 slums selected from 18 intervention municipalities and 50 from control slums from adjacent matching municipalities.

In addition, to make the process more natural, a bonus score is given to mimic stacking interactions between matching nucleotides, with each pair of adjacent matching nucleotides given an additional score 0.5.

The Renilla siRNA had the target sequence AACGCGGCCTCTTCTTATTTA, which was designed using the Qiagen siRNA Design tool and has a perfect match with Renilla luciferase, but nine mismatches and a maximum of six adjacent matching nucleotides when aligned with the sequence of firefly luciferase.

Purine-to-purine intrastrand hole transport between adjacent matched base pairs is also moderately efficient (AG > AA > GG).

Adjacent matched normal tissues from the ipsilateral breast were processed in the same manner as the tumors.

High CD133 expression was detected in 57.30% (137/239) of NSCLC samples, compared with 26.02% (32/123) of adjacent matched tumor tissues.

The only important parameter that should be predefined is the maximal gap size (number of unmatched genes) allowed between two adjacent matched genes.

Only complete datasets for DNA methylation and gene expression available for both tumors and adjacent matched non tumor samples were analyzed (47 cases).

Quantitative methylation profile of the twelve candidate genes were compared among primary tissue, adjacent matched normal tissue and their matched lymph node metastasis using the two-way hierarchical cluster analysis.

a the adjacent matched normal tissues of a primary tumor surgically removed from a cancer patient, according to the description of GSE5364 at GEO and the article by Yu et al. 2008.