additional sites for

USAGE SUMMARY

The phrase "additional sites for" is correct and usable in written English.
You can use it when referring to extra locations or platforms where something can be found or utilized. Example: "We are looking to establish additional sites for our new product launch to reach a wider audience."

✓ Grammatically correct

Science

News & Media

Human-verified examples from authoritative sources

Exact Expressions

31 human-written examples

In addition to microtubule nucleation at centrosomes, it is now becoming clear that multiple additional sites for microtubule nucleation exist within the mitotic cell.

Chromosoma

Additional sites for former Mormons include postmormon.com and exmormonfoundation.org.org

The New York Times

A better simulation, then, would involve pulling up those 14 sites as repeat visits and then opening, say, seven additional sites for the first time.

The New York Times - Tech

Positron annihilation measurements also show that Cu Mg clusters provide additional sites for vacancy stabilisation.

Acta Materialia

The sulfated saccharides and phosphoamino acids may provide additional sites for functional control of N-CAM.

Science Magazine

HHMI plans to announce additional sites for the program, called Med Into Grad, later this year.

Science Magazine

Human-verified similar examples from authoritative sources

Similar Expressions

29 human-written examples

In fact, differences in the usage of an additional site for metal ion coordination have been used as a criterion to classify metalloproteases [ 34, 38].

Bioscience Reports

Moreover, deletion of the two C-terminal glycines of a recombinantly linked ubiquitin has been shown to prevent further ubiquitination, suggesting that these glycines act as an additional site for poly-ubiquitination [ 55].

BMC Plant Biology

The mutation is in the following sequence: GCAAGTTTACCAATCTTCCC G CTGGGTTCCAGTTATCAAGG. As this mutation creates an additional site for restriction endonuclease digestion using TspRI, the mutation was rechecked by TspRI digestion of the PCR product.

BMC Biology

We need to assume three sites: the retinal Schiff base, a counterion that is also part of a binding site for H+ and Na+, and an additional site for H+ that could be analogous to the extracellular proton release site of BR.

Biochemistry

However, the discovery of additional sites of action for endocannabinoids as well as synthetic cannabinoid compounds suggests the existence of additional cannabinoid receptors.

Progress in Neuro-Psychopharmacology and Biological Psychiatry

Expert writing Tips

Best practice

When using "additional sites for", ensure the context clearly defines what the sites are for. Specificity enhances clarity and avoids ambiguity.

Common error

Avoid using "additional sites for" without specifying the purpose or function of those sites. Vague references can confuse readers. Always clarify the intended use.

Linguistic Context

The phrase "additional sites for" functions as a prepositional phrase, typically modifying a noun or verb phrase. It indicates extra locations or platforms serving a specific purpose. Ludwig AI confirms its proper usage across various contexts.

Expression frequency: Common

Frequent in

Science

70%

News & Media

20%

Formal & Business

10%

Less common in

Encyclopedias

0%

Wiki

0%

Reference

0%

Ludwig's WRAP-UP

The phrase "additional sites for" is a grammatically correct and commonly used prepositional phrase that specifies extra locations or platforms serving a particular purpose. As Ludwig AI confirms, it's suitable for diverse contexts, including scientific, news, and business domains. When employing this phrase, clarity is key; always specify the intended function of these additional sites. While alternatives like "more locations for" and "extra places for" exist, "additional sites for" maintains a neutral to formal register, making it versatile for various writing styles.

More alternative expressions

Phrases that express similar concepts, ordered by semantic similarity:

more locations for

Replaces "additional" with "more", focusing on quantity.

extra places for

Substitutes "sites" with "places", offering a more general term.

further locations for

Uses "further" instead of "additional", implying a continuation or extension.

supplementary venues for

Replaces both "additional" and "sites" with more formal synonyms.

alternative spots for

Focuses on different rather than just extra sites.

expanded areas for

Suggests an increase in the available space.

new locations for

Highlights the novelty of the sites.

reserve spaces for

Implies a backup or contingency plan.

secondary positions for

Indicates a less important or supportive role for the sites.

alternate locations to

Substitutes 'sites for' with a different preposition.

FAQs

How can I use "additional sites for" in a sentence?

You can use "additional sites for" to indicate extra locations or platforms serving a specific purpose. For example, "We need to find additional sites for our product launch".

What are some alternatives to "additional sites for"?

Alternatives include "more locations for", "extra places for", or "further locations for", depending on the specific context.

Is there a difference between "additional sites for" and "alternative sites for"?

"Additional sites for" implies adding more locations to the existing ones, whereas "alternative sites for" suggests different options or replacements for the current locations.

When is it appropriate to use "additional sites for" in formal writing?

It's appropriate in any context where you need to refer to extra places or locations that serve a particular function. It is suitable for "formal and business", scientific, or news contexts.