The phrase "adapter adapter" is not correct and does not convey a clear meaning in written English.
It may be used in a technical context where a specific type of adapter is being referred to, but it lacks clarity without additional context.
Example: "The device requires an adapter adapter to function properly with the new system."
Alternatives: "dual adapter" or "adapter for adapters".
A common adapter (adapter 2) was ligated onto the MspI cut site of all samples.
Approximately 100 ng genomic DNA was digested with PstI /HpaII combination and the resulting fragments ligated to a PstI adapter (Adapter 1: 5'CandAdapterCAGTGCA3' and Adapter 2: 5'CTGGATCC ATCGTGCA3') with T4 DNA ligase (NEB, UK).
We used MIREAP [ 68] to clean the initial sequencing reads by removing poor quality reads, 5' adapter, 3' adapter, reads containing poly(A) stretches, and reads less than 18 bp long.
The FLX specific adapters, Adapter A (GCCTCCCTCGCGCCATCAG) and Adapter B (GCCTTGCCAGCCCGCTCAG), were added to each fragmented cDNA, resulting in Adapter A-DNA fragment-Adapter B constructs.
Adapters were annealed by combining 25 picomoles of the forward and reverse adapters (Adapter F: P –B'AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG and Adapter R: ACACTCTTTCCCTACACGACGCTCTTCCGATCTBT [Illumina; Oligonucleotide sequences © 2007 2009 Illumina, Inc.
Second, the kit contains blockers for the adapters that prevent nonspecific capture via adapter-adapter annealing.
First, by blocking the adapter sequences flanking each of the genomic fragments, we reduced the non-specific pull down through adapter-adapter hybridization.
Samples with the lowest RIN values had the highest percentage of reads removed due to size (<15 nt) and adapter-adapter ligation.
We assumed that possible hybridization between different genomic targets based on adapter-adapter hybridization will lead to the inadvertent and non-specific enrichment of off-target fragments.
We found that size-selection and purification of the ligation products by agarose gel before amplification of the library by PCR resulted in better libraries and decreased the incidence and intensity of an adapter-adapter band at ~120 bp.
A very small number of reads were removed due to adapter-adapter ligation, but nonetheless, PPS showed the lowest percentage (0.03 %), while Novex, AMPure and control showed 0.05%%, 0.15 % and 0.53 %, respectively.
