Sentence examples for achieving a pair from inspiring English sources

For symmetric probability density functions (PDFs), e.g., the ones illustrated in Fig. 1, achieving a pair (P fa,P md) on the support P fa∈[0,0.5],P md∈[0,0.5], i.e., being robust, means that the threshold cannot be above the mean of the (mathcal {H}_{1}) PDF because this would result in a P md>0.5.

Herein, five simpler structures were fabricated and tested together with the structure mentioned above for both direct current (DC) and alternating current (AC) modes of quantum efficiency under forward bias and four types (470 nm, 525 nm, 780 nm, 850 nm) of monochromatic light to achieve a pair of I-V curves under different light intensities.

For example: Nothing: If your hold cards are unsuited and lower than at least 1 of the cards in the flop, you have 6 outs to achieve a pair.

45During England's hiding of Australia in the second Ashes Test in Adelaide, the hosts' Ryan Harris achieved a "king pair".

Due to the large downlink transmission losses, achieving a high enough entangled pair coincidence rate between the OGS and the CubeSat requires a high pair-production rate onboard CQuCoM, consequently we need high-speed single photon counters.

Under a fixed, there exist an infinite number of threshold pairs achieving a fixed.

In the present study, we managed to increase the number of father son pairs drastically to 2,378 pairs, now achieving a differentiation rate of 26.9%95%5% confidence interval 25.1%28.7%%).

In one such approach [13], 3-D similarity is recast to use a binary fingerprint to achieve a conformer pair-wise similarity overlap computation speed similar to that of 2-D similarity computation.

To achieve a simultaneously paired LVSV measurement of identical heart beats by EV and TTE, the echocardiography used in the present study was only in a single plane rather than in two opposing planes.

Moreover, the best performance is achieved with a pair of additional data sources (supplementary Figure (b)), and adding more information sources into this pair cannot further improve the accuracy.

And for Oant_0828 (bvrR): oantbvrR.3 GACGACGACCGCAACATCCTG and oantbvrR.5 CGAAGATCGCAAGATTGGGC. Positive controls of amplification of genomic DNA or cDNA were achieved using a pair of primers oantl12.3 CTGTCGGCACTGACCGTTCTCG and oantl12.5 CGCCACCAGCAGCAGCAACTG interrogating locus Oant_1946, encoding the ribosomal protein L7/L12.