Sentence examples for according to pilot from inspiring English sources

An entry point for each grade level and a basal rule were set according to pilot testing on 90 kindergartners and junior primary school students.

According to pilot study guidelines [ 24], our research questions and methods were designed to reflect those to be used in a subsequent, larger investigation of the subject.

This is based on the 80% probability of detecting statistically and clinically significant differences in maximal exercise capacity (incremental shuttle walk test [ISWT]) [ 18] and HRQoL (Chronic Respiratory Questionnaire [CRQ] total score), according to pilot data from 33 patients with bronchiectasis who completed PR at Alfred Health.

According to Pilot et al. [ 1] this fact may also offer an explanation as to why replacement was only partial in Europe but complete in North America, as horses, one of the most important prey species of Pleistocene wolves, went extinct in North America but survived in Europe.

According to pilots in Florida who know Mr. Chacon, he could also be reckless when flying.

Several British flights to the United States have been delayed for hours as American officials pored over the flight lists, according to pilots and airline officials.

According to pilots hired for the project, the production company, Instinct Productions, had scouted three locations for the filming, two in the Bahamas and one in Jamaica.

The nucleotide positions are chosen according to Pilot-Matias et al (1989): 161 (TGTGTGTGAGAGTGAGGGTGTAAG; antisense, position 3174 3197) and 172 (CTGGTCATCGACTACTTCCA; sense position 2561 2581).

Data and pilot subcarriers are multiplexed according to the pilot pattern in Figure 2. Due to the fact that in this study both BS and RN are equipped with two antennas, we consider that each antenna path has different subsets of pilot subcarriers, according to Figure 2. Two consecutives pilot subcarriers are spaced by N f, or 2 N f if considering a specific antenna.

The plane ditched in 3,600 feet of shark-infested ocean, the couple apparently died (according to the pilot they remained in the plane, unmoving as it sank) and the pilot himself, 36-year-old Thomas Hayashi, was subsequently rescued.

According to Nielsen Media Research, "Pilot" was watched by 6.77 million households in its original airing.