Your English writing platform
Discover LudwigSuggestions(5)
The phrase "according to cases" is correct and usable in written English
It can be used when referencing specific instances or examples that support a statement or argument. Example: "According to cases presented in the report, the new policy has significantly improved employee satisfaction."
Exact(7)
The elapsed times for the peak were different according to cases.
Then local stable and unstable manifolds of the origin exist according to cases (a)–(d) given below.
Note that according to cases (a) and (b), shown in expressions (9) and (10), the frontier between regions (II) and (III) is determined by the equation ( z=4k-3 ).
According to cases 1, 2, and 3, simulation results show that v fs is also approximately equal to r/∆T, although there are changes in contact duration of virus, communication radius of node, distribution density of node, and the number of initial infected nodes.
The incidence rate of goat melioidosis was low in the south, where the incidence of human infection has not been defined but appears to be low according to cases reported in the literature (12 – 12 ).
If the IME-EF4 has the protruding cohesive end situation according to cases 1, then there would be signals after either the terminal sequence GAGATTCGTTTAAGCGAAAG, ATTTTTTGAAGAAACTAATA, or both of them in the terminal run-off sequencing result.
Similar(53)
Her father and mother were very young and entirely unprepared for parenthood, according to Case.
To estimate the risk of postoperative complications in robotic-assisted gynecologic surgery according to case type.
According to case reports, dysphagia or airway obstruction resulting from DISH is a rare occurrence.
Homes there lost more than half their value, according to Case-Shiller data.
Not every market is showing improvement on the low end, according to Case-Shiller.
Write better and faster with AI suggestions while staying true to your unique style.
Since I tried Ludwig back in 2017, I have been constantly using it in both editing and translation. Ever since, I suggest it to my translators at ProSciEditing.

Justyna Jupowicz-Kozak
CEO of Professional Science Editing for Scientists @ prosciediting.com