Sentence examples for according and from inspiring English sources

Everyone who worked hard for me will be paid according, and some of the money I spent, which was significant, will be paid, too.

Waist circumference was measured in orthostatism with the patient standing relaxed, arms freely hanging at each side, and feet close together by using a flexible plastic tape to the nearest 1 cm according and classified to NECP ATP III [17].

fThe libraries were prepared according and 24 h cold stress were used for total RNA isolation.

Having two broader categories – (1) CHWs that are trained to be part of the formal work force and paid according and (2) CHWs that receive minimal training and offer limited hours according to the context – may be more useful.

shRNA Set9 F: TGAACTTTGTTCACGGAGAATTCAAGAGATTC TCCGTGAACAAAGTTCTTTTTTC shRNA Set9 R: TCGAGAAAAAAGAACTTTGTTCACGGAGAAT CTCTTGAATTCTCCGTGAACAAAGTTCA These oligonucleotides were annealed and cloned into pSicoR (PSR) between the HpaI and Xho1 sites according and annealed as described (http://web.mit.edu/jacks-lab/protocols/pSico.html).

Maintain your appliances according, and don't rule out repairing an old one if it's still doing the job.

Umlauts are sometimes accorded and sometimes withheld, without system, like honours in some petty German dukedom.

Let, be independent random variables drawn according to, and, be independent and drawn according to, and let be independent of.

XTHs and expansins were named according to and respectively.

And according to Berkun and Gallo, neither should you.

Table 1 proADM according etiology and survival.