Sentence examples for abundant words from inspiring English sources

We then extracted unusually rare and unusually abundant words, which we define as those having | r(w)| > R.

Similarly, in D. ananassae, 25 of the 50 most abundant words in the X do not correspond to simple sequences.

Thus, we have detected that 26 of the most abundant words in D. virilis can be assembled to build a 36 bp sequence (GGAGTTATGTTTTGGAACGTCATATCTCCGCGC).

On the one hand, this is caused by great differences between ritual and daily discourses, the former involving abundant unfamiliar words (e.g., name of spirits and gods), "versification," and long articles, which caused difficulties to understand.

The word "keep" and its variants occur forty-seven tines iNorthrth of Boston"; some of Frost's greatest poems, from later in his career ("The Most of It" and "Directive" both come to mind), turn on that weirdly abundant little word.

Still, the abundant F-word isn't so much a birdie to the denizens of midtown Manhattan as a fuck-you to the American financial system, which has lured Sillerman and his particular brand of business live-music roll-up conglomerates—business live-music world's biggest concert venues and on the stoconglomerates back

Overall, the impact on the fraction of proliferating cells at steady state was directly opposite to the abundance of the given subset; in other words, abundant subsets tended to turn over less vigorously in O treated mice, and these values were similar to untreated A mice.

Nuances abundant in a word in one language are entirely absent in another.

But with carefully chosen words and abundant politeness, Mr. Donohue said several times that neither he nor Mr. Yoo made any specific promises to the families, who had donated more than $36,000 to Mr. Pataki's campaign.

Public figures, who cannot help displaying many of their best and worst qualities for all to see, and who leave abundant records of their words and actions, have always provided an attractive subject pool for personality researchers, stretching as far back as Freud, who analyzed the long-dead Leonardo da Vinci.

To perform our experiments, we collected food comments and product comments from the Internet, where polar words are abundant.