Sentence examples for abundant representatives from inspiring English sources

Similar motifs were combined and sequence logos of the ten most abundant representatives are shown.

Other genera with abundant representatives among our isolates were Chromohalobacter and Halomonas which have been reported to produce metabolites with antimicrobial and cytotoxic activity.

We chose these two species because they are abundant representatives of lawn and bunch grasses in HiP, and dominated in the area surrounding our field experiment.

N-chlorotaurine (Cl HN CH2 CH2 SO3 −, NCT) is the most abundant representative of this class of compounds (Grisham et al. 1984).

In some forest types, such as tabonuco forest, they are the major arboreal invertebrate predators; spiders being the most abundant representative.

Typically we chose only the most abundant representative of such variants as a candidate.

Palmitic acid is the main product of fatty acid synthesis and an abundant representative fatty acid in the neutral lipid fraction of N. vitripennis.

The obtained concatemers, containing abundant representative cDNA fragments, were ligated into the pZErO-1 vector (Invitrogen) and cloned into E. coli cells.

Photoreceptor's membrane is characterised by a unique composition of lipids, predominantly containing PUFAs, with the most abundant representative being docosahexanoic acid (DHA) (22 6 ω3), exclusively of dietary origin.

The most abundant representative sequence of each of the most abundant clusters, altogether encompassing >90% of the sequences, was translated into amino acid sequence using the ORF Finder tool of the Sequence Manipulation Suite (http://www.bioinformatics.org/sms2/).org/sms2/

We used miRNA mimics for two abundant representative sequences containing ACAGUAC or UACAGUA seeds: The miRBase reference miR-101 UACAGUACUGUGAUAACUGAA, and one of the most abundant miR-101 5'-isomiRs presentheg the same length as the reference miR-101 GUACAGUACUGUGAUAACUGA (Additional file 1: Figure S1).