Sentence examples for abnormally interesting from inspiring English sources

His talent: finding regular people who, trapped in artificial constructions with cameras rolling, are abnormally interesting.

The exhibition "was a wonderful moment in the history of celebrity culture," said Joseph Roach, a professor of theater and English at Yale University and the author of "It" (2007), a cultural history of the charisma that distinguishes "abnormally interesting" people.

The nuclease that promotes SLX4-dependent telomere shortening could be MUS81-EME1 and/or SLX1; it will be interesting to test the relevant knockout mice for abnormally long telomeres.

We do not know if the genes encoding these RNA processing factors are mutated in SALS, similar to FUS/TLS or TDP-43, or if they are abnormally regulated downstream of primary disease-causing genes, but they represent interesting candidates for further analysis.

It didn't happen, but the result was interesting: Oct4 activation in mice made adult stem cells multiply abnormally and become cancerous.

As lupus T cells are abnormally resistant to the induction of apoptosis, targeting this population may represent an interesting alternative.

"If I haven't already, I will subtly show some intelligence, I will behave a bit abnormally, as that is more comfortable, and I will try to be become the most interesting person they know by telling them a true story about myself".

Another interesting finding was that one of the intron sites, I1-1 (GGGTGGGAAAATAGACCAATAGG), had off-target sites abnormally enriched in TFBS of NF-YA, a CCAAT-binding protein.

It is interesting to note that in flies subjected to C765-Gal4-mediated C765-Gal4-mediated C765-Gal4-mediatedpartmentSbare abnormally small.

Abnormally big.

I sweat abnormally.