Using data from two field trials, these authors examined the 12-item WHO-DAS II (screener version that possessed different items) by means of confirmatory factor analysis, non-parametric (Mokken scale analysis) and parametric (Birnbaum's two-parametric model) methods of IRT.
Mr. Harris suggested a version of that.
According to miRBase, Caenorhabditis elegans (nematode), Drosophila melanogaster (fly), Xenopus tropicalis (frog), Danio rerio (zebra fish), Gallus gallus (chicken), Canis familiaris (dog), Mus musculus (mouse) and Homo sapiens (human) all express a version of let-7 (let-7a) that possesses the exact consensus sequence of 'UGAGGUAGUAGGUUGUAUAGUU' (Fig. 2A).
Melanie McFarland of the Seattle Post-Intelligencer, meanwhile, said the show "never found the sense of uniqueness within the Trek universe that every version that came before it possessed".
A 'punctured version' of the 3D MIMO code that possesses full rate with low decoding complexity has also been proposed [17].
The first category is found in most vertebrates (red shading), which possess a version of SBP2 that contains a ~400 amino acid N-terminal extension upstream of two domains known to be required for Sec incorporation: the Sec incorporation domain (SID) and the SECIS RNA binding domain (RBD).
A top Democratic senator, Carl Levin of Michigan, later complained that the public version of Mr. Duelfer's testimony had omitted information contained in the classified version that would have raised further doubts about whether Iraq possessed illicit weapons at all.
It's the soil, mineral rich from the slate and possessing an exceptional ability to store heat (that's the "nutshell" version), that produces the crisp and fruity taste.
PAGE A8 Self-Help for a Gene Defect In a discovery that poses a puzzle for evolutionary theory, researchers say they have found plants that possess a corrected version of a defective gene inherited from their parents.
A1 SCIENCE/HEALTH Plants and Genetic Memory In a startling discovery, geneticists at Purdue say they have found plants that possess a corrected version of a defective gene inherited from both their parents, as if some handy backup copy with the right version had been made in the grandparents' generation or earlier.
